Stem-loop sequence mml-mir-519e

AccessionMI0020901 (change log)
DescriptionMacaca mulatta miR-519e stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   ---------gagaaga     u     c  u      u    a  a   u    -g  cu 
5'                 ucuca gcagu au cuccaa ggga gc ccu cugu  gu  g
                   ||||| ||||| || |||||| |||| || ||| ||||  ||   
3'                 agagu uguca ua gagguu uccu cg gga gacg  cg  a
   ugaagcugcaccaaug     u     u  c      u    c  -   -    aa  aa 
Get sequence
Deep sequencing
257 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49028305-49028414 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-519e
mml-mir-1323chr19: 49019624-49019731 [+]
mml-mir-498chr19: 49021679-49021802 [+]
mml-mir-519echr19: 49028305-49028414 [+]
mml-mir-519cchr19: 49030112-49030198 [+]
mml-mir-1283chr19: 49032979-49033088 [+]
mml-mir-520achr19: 49034604-49034688 [+]
Database links

Mature sequence mml-miR-519e

Accession MIMAT0024353
Sequence

21 - 

uucuccaaugggaagcaccuuc

 - 42

Get sequence
Deep sequencing236 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).