Stem-loop sequence mml-mir-1283

AccessionMI0020900 (change log)
DescriptionMacaca mulatta miR-1283 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   --------------gaaca  c          c   ac     a    a      guug  g 
5'                    uc caggcuguga ucu  aaagg aagc cuuucu    uc a
                      || |||||||||| |||  ||||| |||| ||||||    ||  
3'                    ag guuuggcauu aga  uuucc uucg gaaaga    ag a
   aguugaaguugugacgaaa  a          a   gu     c    c      --aa  a 
Get sequence
Deep sequencing
190 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49032979-49033088 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-1283
mml-mir-519echr19: 49028305-49028414 [+]
mml-mir-519cchr19: 49030112-49030198 [+]
mml-mir-1283chr19: 49032979-49033088 [+]
mml-mir-520achr19: 49034604-49034688 [+]
mml-mir-526bchr19: 49038951-49039033 [+]
mml-mir-519a-2chr19: 49039745-49039863 [+]
mml-mir-525chr19: 49042145-49042230 [+]
mml-mir-523achr19: 49042991-49043077 [+]
Database links

Mature sequence mml-miR-1283

Accession MIMAT0024352
Sequence

21 - 

cuacaaaggaaagcacuuuc

 - 40

Get sequence
Deep sequencing186 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).