Stem-loop sequence mml-mir-3145

AccessionMI0020897 (change log)
DescriptionMacaca mulatta miR-3145 stem-loop
Gene family MIPF0001427; mir-3145
Stem-loop
   ugaaaggaaaaaa      ----        g    c               cg auu   ga 
5'              uguauu    cauauaag ucaa uccaaacauucaaaa  c   guu  a
                ||||||    |||||||| |||| |||||||||||||||  |   |||   
3'              acauag    guauguuc aguu agguuugugaguuuu  g   uaa  u
   -------------      ucac        a    a               au gau   gg 
Get sequence
Deep sequencing
55 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr4: 128858760-128858870 [+]
intergenic
Database links

Mature sequence mml-miR-3145-5p

Accession MIMAT0027120
Sequence

31 - 

aacuccaaacauucaaaacgca

 - 52

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-3145-3p

Accession MIMAT0024349
Sequence

71 - 

uauuuugaguguuuggaauuga

 - 92

Get sequence
Deep sequencing48 reads, 6 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).