Stem-loop sequence mml-mir-514b

AccessionMI0020896 (change log)
DescriptionMacaca mulatta miR-514b stem-loop
Gene family MIPF0000130; mir-506
Literature search

1 open access papers mention mml-mir-514b
(1 sentences)

Stem-loop
   auccuuaaauguucuauucc       g      u    -     gagg         g a 
5'                     ucaugug uacucu cuca agagg    caaucaugu u a
                       ||||||| |||||| |||| |||||    ||||||||| |  
3'                     gguacac augaga gagu ucucc    guuaguaua a u
   -----------uaccuuuau       a      u    g     -aca         g u 
Get sequence
Deep sequencing
92749 reads, 4.36e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 140957046-140957156 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-514b
mml-mir-509-2chrX: 140966410-140966503 [-]
mml-mir-514bchrX: 140957046-140957156 [-]
mml-mir-508chrX: 140953010-140953094 [-]
mml-mir-507chrX: 140947139-140947232 [-]
Database links

Mature sequence mml-miR-514b-5p

Accession MIMAT0027119
Sequence

34 - 

uucucaagagggaggcaauca

 - 54

Get sequence
Deep sequencing979 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-514b-3p

Accession MIMAT0024348
Sequence

71 - 

auugacaccucugugaguaga

 - 91

Get sequence
Deep sequencing91765 reads, 9 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).