Stem-loop sequence mml-mir-1323

AccessionMI0020894 (change log)
DescriptionMacaca mulatta miR-1323 stem-loop
Gene family MIPF0000617; mir-1323
Literature search

1 open access papers mention mml-mir-1323
(3 sentences)

Stem-loop
   ------------   -c     g -c                 a  g         guga 
5'             uga  auuca a  ugauguccucaaaacug gg gcauuuucu    u
               |||  ||||| |  ||||||||||||||||| || |||||||||    u
3'             acu  uaagu u  acuguagggguuuugac cc cgugaaagg    u
   uuacccaauacu   ca     g ua                 -  a         aaag 
Get sequence
Deep sequencing
754 reads, 100 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49019624-49019731 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-1323
mml-mir-512chr19: 49017521-49017604 [+]
mml-mir-1323chr19: 49019624-49019731 [+]
mml-mir-498chr19: 49021679-49021802 [+]
mml-mir-519echr19: 49028305-49028414 [+]
Database links

Mature sequence mml-miR-1323-5p

Accession MIMAT0024346
Sequence

21 - 

ucaaaacugaggggcauuuuc

 - 41

Get sequence
Deep sequencing748 reads, 3 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence mml-miR-1323-3p

Accession MIMAT0027118
Sequence

56 - 

aaagugcacccaguuuugggg

 - 76

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).