Stem-loop sequence mml-mir-1255b

AccessionMI0020890 (change log)
DescriptionMacaca mulatta miR-1255b stem-loop
Gene family MIPF0000506; mir-1255
Stem-loop
   ------------cuucacu                    a                 gagc 
5'                    aggaguugcuucuuacggau agcaaagaaagugguuu    c
                      |||||||||||||||||||| |||||||||||||||||     
3'                    uccucaacgaggaaugucua ucguuucuuucaccaaa    u
   cuauuuugaacuugucuau                    c                 ggac 
Get sequence
Deep sequencing
103 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 199689428-199689539 [-]
intergenic
Database links

Mature sequence mml-miR-1255b

Accession MIMAT0024342
Sequence

21 - 

uacggauaagcaaagaaagugg

 - 42

Get sequence
Deep sequencing97 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).