Stem-loop sequence mml-mir-4796

AccessionMI0020889 (change log)
DescriptionMacaca mulatta miR-4796 stem-loop
Gene family MIPF0001402; mir-4796
Stem-loop
   ggcuca     --u   ag                               --uu    c 
5'       aguca   ggc  uaaauuugugucuauacucugccacuuuacu    uggc u
         |||||   |||  |||||||||||||||||||||||||||||||    |||| c
3'       ucagu   ccg  auuuaaacacagaugugagacggugaaaugg    acug a
   ----cc     cuu   -g                               cguu    a 
Get sequence
Deep sequencing
477 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr2: 35769943-35770054 [-]
sense
ENSMMUT00000046945 ; ZBTB20-201; intron 3
Database links

Mature sequence mml-miR-4796-5p

Accession MIMAT0027117
Sequence

30 - 

uauacucugccacuuuacu

 - 48

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-4796-3p

Accession MIMAT0024341
Sequence

72 - 

aaguggcagaguguagacacaa

 - 93

Get sequence
Deep sequencing473 reads, 9 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).