Stem-loop sequence mml-mir-1243

AccessionMI0020886 (change log)
DescriptionMacaca mulatta miR-1243 stem-loop
Gene family MIPF0001821; mir-1243
Stem-loop
   cugac    u  uugacuguguacu   a                c  gg       cu cc 
5'      agau gg             cuu uauuuuauuccuguaa ug  ccaguuu  g  c
        |||| ||             ||| |||||||||||||||| ||  |||||||  |  u
3'      ucua cc             gaa auaaagugaggauauu ac  ggucaaa  c  u
   ---cc    -  ------------u   a                a  ua       au aa 
Get sequence
Deep sequencing
370 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr5: 112060510-112060620 [+]
intergenic
Database links

Mature sequence mml-miR-1243-5p

Accession MIMAT0027116
Sequence

38 - 

uccuguaacugggccaguuuc

 - 58

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-1243-3p

Accession MIMAT0024338
Sequence

71 - 

aaacuggaucaauuauaggag

 - 91

Get sequence
Deep sequencing363 reads, 7 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).