Stem-loop sequence mml-mir-891b

AccessionMI0020883 (change log)
DescriptionMacaca mulatta miR-891b stem-loop
Gene family MIPF0000420; mir-891
Stem-loop
   --------------aau        -cuuc     u       a u  a        uucag 
5'                  guugucuc     auccu gcaacga c ug gccauuga     u
                    ||||||||     ||||| ||||||| | || ||||||||     a
3'                  uaauagag     uagga uguuguu g ac cgguaacu     a
   uacuccggaaaucuacc        aaaac     u       c u  a        uacaa 
Get sequence
Deep sequencing
5562 reads, 11.1 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 139731797-139731908 [-]
intergenic
Database links

Mature sequence mml-miR-891b-5p

Accession MIMAT0024335
Sequence

21 - 

ugcaacgaacuugagccauuga

 - 42

Get sequence
Deep sequencing5542 reads, 9 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence mml-miR-891b-3p

Accession MIMAT0027115
Sequence

58 - 

aauggcacaugcuuguuguuag

 - 79

Get sequence
Deep sequencing19 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).