Stem-loop sequence mml-mir-1296

AccessionMI0020876 (change log)
DescriptionMacaca mulatta miR-1296 stem-loop
Gene family MIPF0000649; mir-1296
Stem-loop
   ------------gaau  -       aacu         c cu        cu   u     a 
5'                 ca ccuaccu    ggguuaggg c  ggcuccau  ccu uagga a
                   || |||||||    ||||||||| |  ||||||||  ||| ||||| a
3'                 gu gggugga    cccaauccc g  ucggggug  ggg gucuu c
   uuuaugucgucacaau  c       ----         a cu        ag   u     c 
Get sequence
Deep sequencing
2520 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr9: 69347312-69347423 [+]
intergenic
Database links

Mature sequence mml-miR-1296-5p

Accession MIMAT0024328
Sequence

21 - 

uuagggcccuggcuccaucuccu

 - 43

Get sequence
Deep sequencing2505 reads, 9 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence mml-miR-1296-3p

Accession MIMAT0027114
Sequence

64 - 

gaguggggcuucgacccuaacc

 - 85

Get sequence
Deep sequencing13 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).