Stem-loop sequence mml-mir-676-1

AccessionMI0020873 (change log)
DescriptionMacaca mulatta miR-676-1 stem-loop
Gene family MIPF0000471; mir-676
Stem-loop
   agacuucauauc    u    ccu       ug    uu      c     uu   gaauu 
5'             agau cuca   gaaugca  acuc  caaccu aggac  gca     a
               |||| ||||   |||||||  ||||  |||||| |||||  |||      
3'             uuua gggu   uuugcgu  ugag  guugga uccug  cgu     a
   ------------    c    --c       gu    uu      a     -c   aaggu 
Get sequence
Deep sequencing
2189 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 64701793-64701901 [+]
antisense
ENSMMUT00000047961 ; TEX11-202; intron 2
ENSMMUT00000004319 ; TEX11-201; intron 12
Database links

Mature sequence mml-miR-676-5p

Accession MIMAT0027113
Sequence

35 - 

cucuucaaccucaggacuugca

 - 56

Get sequence
Deep sequencing32 reads, 7 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-676-3p

Accession MIMAT0024325
Sequence

71 - 

ccguccuaagguuguugaguu

 - 91

Get sequence
Deep sequencing3796 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).