Stem-loop sequence mml-mir-3200

AccessionMI0020871 (change log)
DescriptionMacaca mulatta miR-3200 stem-loop
Gene family MIPF0001441; mir-3200
Stem-loop
   agagagacaaagaa     u gu    g a       aa      ca    uu   uc aa 
5'               ggagg g  cgag g aucugag  ggcgca  aggu  gug  c  u
                 ||||| |  |||| | |||||||  ||||||  ||||  |||  |   
3'               ccucc c  gcuc u uggacuc  ucgcgu  ucca  cac  g  a
   --------uaguac     - gu    g c       -a      --    --   cu ac 
Get sequence
Deep sequencing
1420 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr10: 72589387-72589496 [+]
sense
ENSMMUT00000003078 ; SFI1-201; intron 6
ENSMMUT00000003077 ; SFI1-202; intron 6
Database links

Mature sequence mml-miR-3200-5p

Accession MIMAT0027112
Sequence

29 - 

gaaucugagaaggcgcacaagguuugug

 - 56

Get sequence
Deep sequencing73 reads, 6 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-3200-3p

Accession MIMAT0024323
Sequence

71 - 

caccuugcgcuacucaggucug

 - 92

Get sequence
Deep sequencing1345 reads, 9 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).