Stem-loop sequence mml-mir-1262

AccessionMI0020869 (change log)
DescriptionMacaca mulatta miR-1262 stem-loop
Gene family MIPF0000595; mir-1262
Stem-loop
   uugaccauaaaaaauaa     g   a                             -   au 
5'                  auucu uga uuucauccuucuauaaauucauccaucac auu  c
                    ||||| ||| ||||||||||||||||||||||||||||| |||   
3'                  uaaga acu agaguaggaagauguuuaaguggguagug uaa  u
   -------------uucc     a   g                             g   ga 
Get sequence
Deep sequencing
4035 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 67962083-67962194 [-]
intergenic
Database links

Mature sequence mml-miR-1262-5p

Accession MIMAT0027111
Sequence

36 - 

uucuauaaauucauccaucaca

 - 57

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-1262-3p

Accession MIMAT0024321
Sequence

71 - 

ugaugggugaauuuguagaagg

 - 92

Get sequence
Deep sequencing4029 reads, 9 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).