Stem-loop sequence mml-mir-1255a

AccessionMI0020868 (change log)
DescriptionMacaca mulatta miR-1255a stem-loop
Gene family MIPF0000506; mir-1255
Stem-loop
   -----------------                        u gaa           ag 
5'                  gaguugcuucucaaggaugagcaa g   guaguuuuuuu  a
                    |||||||||||||||||||||||| |   |||||||||||  u
3'                  cucaacgaagaguuucuacucguu c   caucaaagaaa  u
   uuuaaaauuaccuauuu                        u auc           cc 
Get sequence
Deep sequencing
942 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr5: 100144124-100144227 [-]
intergenic
Database links

Mature sequence mml-miR-1255a-5p

Accession MIMAT0024320
Sequence

14 - 

aggaugagcaauggaaguagu

 - 34

Get sequence
Deep sequencing940 reads, 7 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence mml-miR-1255a-3p

Accession MIMAT0027110
Sequence

55 - 

cuaccuacuuugcucaucuuug

 - 76

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).