Stem-loop sequence mml-mir-1298

AccessionMI0020864 (change log)
DescriptionMacaca mulatta miR-1298 stem-loop
Gene family MIPF0000598; mir-1298
Literature search

1 open access papers mention mml-mir-1298
(1 sentences)

Stem-loop
   gagagac       u         u    c             ------       ucc 
5'        gaggagu aagaguuca ucgg uguccagauguau      ccaagua   u
          ||||||| ||||||||| |||| |||||||||||||      |||||||    
3'        cuuuucg uuuucaagu aguc acgggucuacaua      gguuuau   c
   ----gua       c         c    a             aauaac       ugu 
Get sequence
Deep sequencing
1940 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 108589563-108589672 [+]
antisense
ENSMMUT00000047835 ; LRCH2-201; intron 13
ENSMMUT00000024354 ; LRCH2-202; intron 14
Database links

Mature sequence mml-miR-1298-5p

Accession MIMAT0024316
Sequence

21 - 

uucauucggcuguccagaugua

 - 42

Get sequence
Deep sequencing177 reads, 9 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence mml-miR-1298-3p

Accession MIMAT0027109
Sequence

75 - 

caucugggcaacugacugaacu

 - 96

Get sequence
Deep sequencing1755 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).