Stem-loop sequence mml-mir-1271

AccessionMI0020863 (change log)
DescriptionMacaca mulatta miR-1271 stem-loop
Gene family MIPF0000483; mir-1271
Stem-loop
   ---------     ----  a  -   au             c     a           a 
5'          cccca    gc cc cag  cagugcuuggcac uagca gcacucaguaa u
            |||||    || || |||  ||||||||||||| ||||| |||||||||||  
3'          ggggu    cg gg guc  guuacgggccgug aucgu cgugaguuguu a
   ggagaccua     guuu  -  a   gu             u     c           c 
Get sequence
Deep sequencing
830 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr6: 174823229-174823337 [+]
antisense
ENSMMUT00000005665 ; AGXT2L2-203; intron 7
ENSMMUT00000040571 ; AGXT2L2-201; intron 9
ENSMMUT00000005663 ; AGXT2L2-202; intron 10
Database links

Mature sequence mml-miR-1271-5p

Accession MIMAT0024315
Sequence

21 - 

cuuggcaccuagcaagcacuca

 - 42

Get sequence
Deep sequencing792 reads, 9 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence mml-miR-1271-3p

Accession MIMAT0027108
Sequence

58 - 

gugccugcuaugugccgggca

 - 78

Get sequence
Deep sequencing34 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).