Stem-loop sequence mml-mir-873

AccessionMI0020859 (change log)
DescriptionMacaca mulatta miR-873 stem-loop
Gene family MIPF0000390; mir-873
Stem-loop
   -----------------   uaa       u ca   g a      ug g        a  ga 
5'                  gaa   guuugug g  uuu c ggaacu  u agucuccu uu  a
                    |||   ||||||| |  ||| | ||||||  | |||||||| ||  a
3'                  cuu   uaaacac c  aag g ccuuga  a ucagagga aa  a
   cgucaucuuuacucauc   --c       c ac   g c      gu g        c  gu 
Get sequence
Deep sequencing
4591 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr15: 54963981-54964090 [+]
intergenic
Database links

Mature sequence mml-miR-873-5p

Accession MIMAT0024311
Sequence

21 - 

gcaggaacuugugagucucc

 - 40

Get sequence
Deep sequencing3046 reads, 9 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence mml-miR-873-3p

Accession MIMAT0027106
Sequence

58 - 

agacugaugaguucccggga

 - 77

Get sequence
Deep sequencing1545 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).