Stem-loop sequence mml-mir-4446

AccessionMI0020858 (change log)
DescriptionMacaca mulatta miR-4446 stem-loop
Gene family MIPF0001385; mir-4446
Stem-loop
   uacuucaggauugaugaguccg   -  uc  gu       c      uuc      cuuca 
5'                       gug gc  ug  ccauuuc cugcca   ccuugg     a
                         ||| ||  ||  ||||||| ||||||   ||||||     u
3'                       cac cg  ac  gguagag gacggu   gggacc     u
   --------------cacuucca   u  ga  ug       u      --c      cucau 
Get sequence
Deep sequencing
42252 reads, 111 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr2: 34627123-34627232 [+]
intergenic
Database links

Mature sequence mml-miR-4446-5p

Accession MIMAT0027105
Sequence

34 - 

ccauuucccugccauucccuuggc

 - 57

Get sequence
Deep sequencing24 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-4446-3p

Accession MIMAT0024310
Sequence

71 - 

cagggcuggcagugagauggg

 - 91

Get sequence
Deep sequencing42228 reads, 9 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).