Stem-loop sequence ggo-mir-18b

AccessionMI0020857 (change log)
DescriptionGorilla gorilla miR-18b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   --------    a  u  cu         --   u    c   u     ua  --g     
5'         uaua ug gu  cuuguguua  agg gcau uag gcagu  gu   aagc 
           |||| || ||  |||||||||  ||| |||| ||| |||||  ||   ||| a
3'         auau au cg  ggacacggu  ucc cgua auc cguca  ua   uucg 
   uuuacgac    a  c  uc         cu   c    a   c     uc  aga     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chrX: 134207967-134208075 [-]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-18b
ggo-mir-106achrX: 134208148-134208228 [-]
ggo-mir-18bchrX: 134207967-134208075 [-]
ggo-mir-20bchrX: 134207730-134207842 [-]
ggo-mir-19b-2chrX: 134207621-134207716 [-]
ggo-mir-92-2chrX: 134207488-134207562 [-]
ggo-mir-363chrX: 134207311-134207423 [-]
Database links

Mature sequence ggo-miR-18b

Accession MIMAT0024309
Sequence

20 - 

uaaggugcaucuagugcagu

 - 39

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).