Stem-loop sequence ggo-mir-502b

AccessionMI0020856 (change log)
DescriptionGorilla gorilla miR-502b stem-loop
Gene family MIPF0000139; mir-500
Stem-loop
   cucacagggcuuuguguucu    c c     -u         uac ug    agag   ugu 
5'                     gcuc c cucuc  aauccuugc   c  ggug    ugc   c
                       |||| | |||||  |||||||||   |  ||||    |||   u
3'                     cgag g gagag  uuaggaacg   g  ccac    acg   g
   -------------ucuacuu    a c     uc         --- gu    -gua   uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chrX: 50442355-50442465 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-502b
ggo-mir-532chrX: 50437081-50437191 [+]
ggo-mir-188chrX: 50437431-50437541 [+]
ggo-mir-502bchrX: 50442355-50442465 [+]
ggo-mir-362chrX: 50442879-50442987 [+]
ggo-mir-660chrX: 50447197-50447306 [+]
ggo-mir-502achrX: 50448538-50448649 [+]
Database links

Mature sequence ggo-miR-502b

Accession MIMAT0024308
Sequence

72 - 

augcaccugggcaaggauucuga

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).