Stem-loop sequence ggo-mir-200b

AccessionMI0020847 (change log)
DescriptionGorilla gorilla miR-200b stem-loop
Gene family MIPF0000019; mir-8
Literature search

1 open access papers mention ggo-mir-200b
(1 sentences)

Stem-loop
   cggcccccggaccca  uc    ag    g c    -    ug     c      u  ag 
5'                gc  gggc  ccgu g cauc uuac  ggcag auugga gg  u
                  ||  ||||  |||| | |||| ||||  ||||| |||||| ||  c
3'                cg  cccg  ggcg c guag aaug  ccguc uaaucu cu  a
   --------cgacgca  -u    -a    g a    u    gu     a      -  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr1: 808769-808879 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-200b
ggo-mir-200bchr1: 808769-808879 [+]
ggo-mir-200achr1: 809523-809633 [+]
ggo-mir-429chr1: 810595-810705 [+]
Database links

Mature sequence ggo-miR-200b

Accession MIMAT0024299
Sequence

69 - 

uaauacugccugguaaugaugac

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).