Stem-loop sequence ggo-mir-202

AccessionMI0020845 (change log)
DescriptionGorilla gorilla miR-202 stem-loop
Gene family MIPF0000121; mir-202
Stem-loop
   agccggcccuccucagagccg    -       u           -a            aaga 
5'                      cccg ccguucc uuuuccuaugc  uauacuucuuug    u
                        |||| ||||||| |||||||||||  ||||||||||||    c
3'                      gggc ggcgggg aaaaggguacg  auauggagaaau    u
   ---------------ccuccu    u       c           gg            ccgg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr10: 148148374-148148485 [-]
sense
ENSGGOT00000036262 ; ggo-mir-202-201; exon 1
Database links

Mature sequence ggo-miR-202

Accession MIMAT0024297
Sequence

71 - 

aagagguauagggcaugggaaa

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).