Stem-loop sequence ggo-mir-548f

AccessionMI0020842 (change log)
DescriptionGorilla gorilla miR-548f stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ggo-mir-548f
(2 sentences)

Stem-loop
   --------------auuuaaauauuaagcua        g    c ug             c 
5'                                gugcaaaa ugau g  guuuuugccauua u
                                  |||||||| |||| |  |||||||||||||  
3'                                cacguuuu guua c  caaaaacgguagu u
   auaaauuauguugucuuuacaauaauccaac        -    a gu             u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr7: 112426148-112426258 [+]
intergenic
Database links

Mature sequence ggo-miR-548f

Accession MIMAT0024294
Sequence

21 - 

caaaagugaucgugguuuuug

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).