Stem-loop sequence ggo-mir-548d

AccessionMI0020836 (change log)
DescriptionGorilla gorilla miR-548d stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ggo-mir-548d
(2 sentences)

Stem-loop
   --------------cauuuc    a                        g    c  a  a 
5'                     uauu gguuggugcaaaagugauugcagu uuug ca ua a
                       |||| |||||||||||||||||||||||| |||| || ||  
3'                     auaa ccgaccacguuuucauugacguca aaac gu au a
   cuaacaagugacaaccguau    c                        a    a  a  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr4: 87504315-87504424 [+]
sense
ENSGGOT00000004930 ; SHROOM3-201; intron 2
Database links

Mature sequence ggo-miR-548d

Accession MIMAT0024288
Sequence

57 - 

caaaaacugcaguuacuuuug

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).