Stem-loop sequence ggo-mir-556

AccessionMI0020835 (change log)
DescriptionGorilla gorilla miR-556 stem-loop
Gene family MIPF0000475; mir-556
Stem-loop
   ccuaggaguucaca   a                     c  u          cuucau 
5'               aag uaguaauaagaaagaugagcu au guaauaugag      u
                 ||| ||||||||||||||||||||| || ||||||||||       
3'               uuc aucauuauuuuuucuacucga ua cauuauacuu      u
   -----------aac   c                     u  c          uacaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr1: 141273776-141273884 [+]
sense
ENSGGOT00000036122 ; ggo-mir-556-201; exon 1
ENSGGOT00000013800 ; ENSG00000198929-201; intron 5
Database links

Mature sequence ggo-miR-556

Accession MIMAT0024287
Sequence

71 - 

auauuaccauuagcucaucu

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).