Stem-loop sequence ggo-mir-548a

AccessionMI0020826 (change log)
DescriptionGorilla gorilla miR-548a stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ggo-mir-548a
(2 sentences)

Stem-loop
   auuuaugcacugcag              -   u             g u     c a   a 
5'                ggagguauuaaguu ggu caaaaguaauugu g uuuug c uua a
                  |||||||||||||| ||| ||||||||||||| | ||||| | |||  
3'                uuuuuauaguucaa cca guuuucauuaacg u aaaac g aau a
   --------------g              a   c             g c     a c   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr6: 19101466-19101576 [+]
intergenic
Database links

Mature sequence ggo-miR-548a

Accession MIMAT0024278
Sequence

35 - 

aaaaguaauugugguuuuugc

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).