Stem-loop sequence ggo-mir-548e

AccessionMI0020824 (change log)
DescriptionGorilla gorilla miR-548e stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ggo-mir-548e
(2 sentences)

Stem-loop
   cuucugugaucuauggc              a      caa              a   c 
5'                  uuuauuagguuggu caaaag   ucgcgguuuuugcu uua u
                    |||||||||||||| ||||||   |||||||||||||| |||  
3'                  agauaguccaacca guuuuc   agcgucaaaaacgg aau u
   ------------uaaga              c      auc              a   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr10: 125833866-125833975 [+]
sense
ENSGGOT00000008504 ; SHOC2-201; intron 2
Database links

Mature sequence ggo-miR-548e

Accession MIMAT0024276
Sequence

71 - 

aaaaacugcgacuacuuuug

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).