Stem-loop sequence ggo-mir-190b

AccessionMI0020818 (change log)
DescriptionGorilla gorilla miR-190b stem-loop
Gene family MIPF0000076; mir-190
Stem-loop
   --------------cucuccu       u     -u               g     -   aa 
5'                      gccugcu cugug  gauauguuugauauu gguug uuu  u
                        ||||||| |||||  ||||||||||||||| ||||| |||   
3'                      uggacga gacau  uuauacaaacuguaa ucaac aag  u
   cuuucucccaccacgacuuag       c     uc               a     c   ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr1: 133274457-133274568 [-]
intergenic
Database links

Mature sequence ggo-miR-190b

Accession MIMAT0024270
Sequence

21 - 

ugauauguuugauauuggguug

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).