Stem-loop sequence ggo-mir-548c

AccessionMI0020814 (change log)
DescriptionGorilla gorilla miR-548c stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ggo-mir-548c
(2 sentences)

Stem-loop
   ------------ua    ----           u         c      a       uuac 
5'               uugc    uauuagguugg gcaaaagua uugcgg uuuugcu    u
                 ||||    ||||||||||| ||||||||| |||||| |||||||    u
3'               aacg    auaauccaacu cguuuuuau aacgcc aaaacgg    u
   ucaacaucgguuga    uagu           u         u      a       uaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr11: 69602673-69602783 [+]
sense
ENSGGOT00000013323 ; PPFIA1-201; intron 1
ENSGGOT00000036029 ; ggo-mir-548c-201; exon 1
Database links

Mature sequence ggo-miR-548c

Accession MIMAT0024266
Sequence

21 - 

aaaaguacuugcggauuuug

 - 40

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).