Stem-loop sequence ggo-mir-203b

AccessionMI0020812 (change log)
DescriptionGorilla gorilla miR-203b stem-loop
Gene family MIPF0000108; mir-203
Literature search

1 open access papers mention ggo-mir-203b
(1 sentences)

Stem-loop
   gcuccgucgcc uc  -     cc  c            c  a    u    -  a  g gc 
5'            g  gc cgcgc  gc gggucuaguggu cu aaca uuca ca uu c  u
              |  || |||||  || |||||||||||| || |||| |||| || || |   
3'            c  ug gcgcg  cg cccaggucacca ga uugu aagu gu aa g  a
   ---------ac cc  a     --  a            a  a    c    u  c  - ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr14: 88241734-88241845 [-]
antisense
ENSGGOT00000039919 ; ggo-mir-203b-201; exon 1
Database links

Mature sequence ggo-miR-203b

Accession MIMAT0024264
Sequence

71 - 

uugaacuguuaagaaccacugg

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).