Stem-loop sequence ggo-mir-548b

AccessionMI0020808 (change log)
DescriptionGorilla gorilla miR-548b stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ggo-mir-548b
(2 sentences)

Stem-loop
   uauuccauuucagacuauauau                       c      g   uuuau 
5'                       uuagguuggcgcaaaaguaauug gguuuu gcc     u
                         ||||||||||||||||||||||| |||||| |||      
3'                       aauccaaccguguuuucguugac ccaaaa cgg     u
   -------------acacuucau                       u      a   uaacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr6: 121339772-121339882 [-]
sense
ENSGGOT00000011023 ; FAM184A-202; intron 1
Database links

Mature sequence ggo-miR-548b

Accession MIMAT0024260
Sequence

71 - 

caaaaaccucaguugcuuuug

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).