Stem-loop sequence ggo-mir-20b

AccessionMI0020774 (change log)
DescriptionGorilla gorilla miR-20b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   -------------     --gg    u  u     -ca           g     -gu    uu 
5'              agauu    gucc ag aguac   aagugcucaua ugcag   aguu  g
                |||||    |||| || |||||   ||||||||||| |||||   ||||  g
3'              ucuaa    uagg uc ucaug   uucacggguau auguc   ucag  c
   gagguaguuguuc     acaa    u  -     acc           a     auc    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chrX: 134207730-134207842 [-]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-20b
ggo-mir-106achrX: 134208148-134208228 [-]
ggo-mir-18bchrX: 134207967-134208075 [-]
ggo-mir-20bchrX: 134207730-134207842 [-]
ggo-mir-19b-2chrX: 134207621-134207716 [-]
ggo-mir-92-2chrX: 134207488-134207562 [-]
ggo-mir-363chrX: 134207311-134207423 [-]
Database links

Mature sequence ggo-miR-20b

Accession MIMAT0024227
Sequence

21 - 

caaagugcucauagugcagguag

 - 43

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).