Stem-loop sequence ggo-mir-452

AccessionMI0020758 (change log)
DescriptionGorilla gorilla miR-452 stem-loop
Gene family MIPF0000287; mir-452
Stem-loop
   --------------uauaauu  u          aac g        g  a        uuug 
5'                      gc aagcacuuac   u uuugcaga ga acugagac    u
                        || ||||||||||   | |||||||| || ||||||||    a
3'                      cg uucgugaaug   a aaacgucu cu ugacucug    a
   ggauuggagaguuccucgaac  u          --a g        a  c        uauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chrX: 152184539-152184651 [-]
sense
ENSGGOT00000001385 ; GABRE-201; intron 6
Clustered miRNAs
< 10kb from ggo-mir-452
ggo-mir-452chrX: 152184539-152184651 [-]
ggo-mir-224chrX: 152183510-152183590 [-]
Database links

Mature sequence ggo-miR-452

Accession MIMAT0024211
Sequence

21 - 

aacuguuugcagaggaaacuga

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).