Stem-loop sequence ggo-mir-346

AccessionMI0020737 (change log)
DescriptionGorilla gorilla miR-346 stem-loop
Gene family MIPF0000188; mir-346
Stem-loop
   ----------------ag u      g ug    u    cu    -  aug        u  guug 
5'                   g cucugu u  ggcg cugu  gccc gc   ccugccuc cu    c
                     | |||||| |  |||| ||||  |||| ||   |||||||| ||     
3'                   c gagacg g  ccgu gacg  cggg cg   ggacggag ga    u
   uacagggugcguccucgg -      - gu    c    uc    u  --g        -  aguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr10: 100536686-100536797 [-]
sense
ENSGGOT00000012345 ; GRID1-201; intron 1
Database links

Mature sequence ggo-miR-346

Accession MIMAT0024190
Sequence

21 - 

ugucugcccgcaugccugccuc

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).