Stem-loop sequence ggo-mir-370

AccessionMI0020729 (change log)
DescriptionGorilla gorilla miR-370 stem-loop
Gene family MIPF0000167; mir-370
Stem-loop
   --- ag    a   c  a  a  g   g   g  ug aa    - -    uc   cu 
5'    c  uuac cag uc ug gu ccu cug gg  g  ccug g ucug  ugu  g
      |  |||| ||| || || || ||| ||| ||  |  |||| | ||||  |||  u
3'    g  agug guu ag ac cg ggg gac uc  c  gggc c agac  aca  c
   gga gg    g   u  a  -  a   a   g  gu gc    u g    -c   au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr14: 84928779-84928888 [+]
sense
Database links

Mature sequence ggo-miR-370

Accession MIMAT0024182
Sequence

21 - 

gccugcugggguggaaccugguc

 - 43

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).