Stem-loop sequence ggo-mir-122

AccessionMI0020726 (change log)
DescriptionGorilla gorilla miR-122 stem-loop
Gene family MIPF0000095; mir-122
Literature search

1 open access papers mention ggo-mir-122
(2 sentences)

Stem-loop
   ------------gaguuuc        -      gg       c           --u  c 
5'                    cuuagcag agcugu  aguguga aaugguguuug   gu u
                      |||||||| ||||||  ||||||| |||||||||||   ||  
3'                    ggaucguc ucgaua  ucacacu uuaccgcaaac   ca a
   aaauagcucccuuccuaac        a      aa       a           uau  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr18: 55767345-55767453 [+]
intergenic
Database links

Mature sequence ggo-miR-122

Accession MIMAT0024179
Sequence

21 - 

uggagugugacaaugguguuug

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).