Stem-loop sequence ggo-mir-574

AccessionMI0020709 (change log)
DescriptionGorilla gorilla miR-574 stem-loop
Gene family MIPF0000419; mir-574
Stem-loop
   gcgcggccgagggcccugcg      c         a u                 ug  gc 
5'                     ugggug gggcgugug g gugugugugugagugug  uc  u
                       |||||| ||||||||| | |||||||||||||||||  ||   
3'                     acucac cccgcacac c cacacacguacucgcac  gg  c
   --------------ucuggg      a         - -                 cu  gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr4: 38590506-38590615 [+]
intergenic
Database links

Mature sequence ggo-miR-574

Accession MIMAT0024162
Sequence

71 - 

cacgcucaugcacacacccaca

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).