Stem-loop sequence ggo-mir-363

AccessionMI0020704 (change log)
DescriptionGorilla gorilla miR-363 stem-loop
Gene family MIPF0000138; mir-363
Stem-loop
   uuguaa  ug ucu       u   gu         ca  a         -----g   a 
5'       aa  a   guuuugc guu  cggguggau  cg ugcaauuuu      aug g
         ||  |   ||||||| |||  |||||||||  || |||||||||      ||| u
3'       uu  u   caggacg caa  gucuaccua  gc acguuaaaa      uac a
   ---cgg  gu -uc       c   au         ug  -         agagga   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chrX: 134207311-134207423 [-]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-363
ggo-mir-106achrX: 134208148-134208228 [-]
ggo-mir-18bchrX: 134207967-134208075 [-]
ggo-mir-20bchrX: 134207730-134207842 [-]
ggo-mir-19b-2chrX: 134207621-134207716 [-]
ggo-mir-92-2chrX: 134207488-134207562 [-]
ggo-mir-363chrX: 134207311-134207423 [-]
Database links

Mature sequence ggo-miR-363

Accession MIMAT0024157
Sequence

71 - 

aauugcacgguauccaucuguaa

 - 93

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).