Stem-loop sequence ggo-mir-365a

AccessionMI0020697 (change log)
DescriptionGorilla gorilla miR-365a stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
   gccagcugguucgu   c      aa        ac           ----   -   uuu 
5'               uac gcaggg  aaugaggg  uuuugggggca    gau gug   c
                 ||| ||||||  ||||||||  |||||||||||    ||| |||   c
3'               aug cguucu  uuauuccu  aaaauccccgu    cua cac   a
   --------cuccuu   a      cg        -a           aaua   u   cuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr16: 14799432-14799542 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-365a
ggo-mir-193bchr16: 14794087-14794198 [+]
ggo-mir-365achr16: 14799432-14799542 [+]
Database links

Mature sequence ggo-miR-365a

Accession MIMAT0024150
Sequence

71 - 

uaaugccccuaaaaauccuua

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).