Stem-loop sequence ggo-mir-210

AccessionMI0020693 (change log)
DescriptionGorilla gorilla miR-210 stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   gcccacccggca  cc u          gg     c   cc   -      c  c -     
5'             gu  c ccaggcgcag  cagcc cug  cac cgcaca ug g cugc 
               ||  | ||||||||||  ||||| |||  ||| |||||| || | ||| c
3'             cg  g gguccguguc  gucgg gac  gug gcgugu ac c gacc 
   --------agcg  ac -          ua     c   -a   u      c  c a     
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr11: 373150-373260 [-]
sense
ENSGGOT00000037620 ; ggo-mir-210-201; exon 1
Database links

Mature sequence ggo-miR-210

Accession MIMAT0024146
Sequence

70 - 

cugugcgugugacagcggcuga

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).