Stem-loop sequence ggo-mir-193b

AccessionMI0020685 (change log)
DescriptionGorilla gorilla miR-193b stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
   ---------------ggagguu   gu       u    gu         g  a  ag uua 
5'                       gug  cucagaa cggg  uuugagggc ag ug  u   u
                         |||  ||||||| ||||  ||||||||| || ||  |   g
3'                       uac  ggguuuu gccc  aaacucccg uc ac  a   u
   ggacucagggagcgacaggucu   ug       c    ug         g  a  cu uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr16: 14794087-14794198 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-193b
ggo-mir-193bchr16: 14794087-14794198 [+]
ggo-mir-365achr16: 14799432-14799542 [+]
Database links

Mature sequence ggo-miR-193b

Accession MIMAT0024138
Sequence

21 - 

cgggguuuugagggcgagauga

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).