Stem-loop sequence ggo-mir-361

AccessionMI0020683 (change log)
DescriptionGorilla gorilla miR-361 stem-loop
Gene family MIPF0000172; mir-361
Stem-loop
   ----------uuuuccu    uuu      uu         --u  a    u     auaa 
5'                  ggga   gggagc  aucagaauc   cc gggg acuuu    u
                    ||||   ||||||  |||||||||   || |||| |||||     
3'                  uccu   ccuucg  uagucuuag   gg cccc ugaaa    u
   uaagagucucguccucc    uuu      uu         ugu  a    c     aacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chrX: 85637673-85637784 [-]
sense
ENSGGOT00000027822 ; CHM-201; intron 8
ENSGGOT00000032327 ; CHM-202; intron 9
Database links

Mature sequence ggo-miR-361

Accession MIMAT0024136
Sequence

21 - 

uuaucagaaucuccagggguac

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).