Stem-loop sequence ggo-mir-146a

AccessionMI0020682 (change log)
DescriptionGorilla gorilla miR-146a stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   ----------c     -----u      u     uu            c        g  uc 
5'            cgaug      guaucc cagcu  gagaacugaauu cauggguu ug  a
              |||||      |||||| |||||  |||||||||||| |||||||| ||  g
3'            gcuac      uauagg gucga  uucuugacuuaa guguccag ac  u
   ggaguucgcgu     ugucuc      -     -c            a        -  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr5: 144321556-144321664 [+]
intergenic
Database links

Mature sequence ggo-miR-146a

Accession MIMAT0024135
Sequence

21 - 

ugagaacugaauuccaugggu

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).