Stem-loop sequence ggo-mir-331

AccessionMI0020675 (change log)
DescriptionGorilla gorilla miR-331 stem-loop
Gene family MIPF0000199; mir-331
Stem-loop
   cacucccaaggaguu  -  uuu         u        u    u       au ccaga 
5'                ug gu   guuuggguu guucuagg augg cccaggg  c     u
                  || ||   ||||||||| |||||||| |||| |||||||  |     c
3'                ac cg   cgaauccaa caagaucc uauc ggguccc  g     a
   -------------cu  g  -cu         c        -    c       cg accaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr12: 95017959-95018069 [+]
intergenic
chr12: 95022235-95022345 [-]
intergenic
Database links

Mature sequence ggo-miR-331

Accession MIMAT0024128
Sequence

71 - 

gccccugggccuauccuagaac

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).