Stem-loop sequence ggo-mir-383

AccessionMI0020663 (change log)
DescriptionGorilla gorilla miR-383 stem-loop
Gene family MIPF0000137; mir-383
Stem-loop
   ----------cuccac u   c     -c  a      aa    a        uug   gga 
5'                 g cac ugcuc  uc gaucag  ggug uuguggcu   ggu   u
                   | ||| |||||  || ||||||  |||| ||||||||   |||    
3'                 c gug acgag  ag cugguc  ucac gacaccga   cua   a
   acuccauuuuccgauc u   a     aa  a      cg    -        ---   auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr8: 13805144-13805254 [-]
intergenic
Database links

Mature sequence ggo-miR-383

Accession MIMAT0024116
Sequence

21 - 

agaucagaaggugauuguggc

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).