Stem-loop sequence ggo-mir-22

AccessionMI0020644 (change log)
DescriptionGorilla gorilla miR-22 stem-loop
Gene family MIPF0000053; mir-22
Stem-loop
   ccucucac   cucaccu   u   cc               -     a      u  ccu 
5'         gcc       ggc gag  gcaguaguucuucag uggca gcuuua gu   g
           |||       ||| |||  ||||||||||||||| ||||| |||||| ||   a
3'         cgg       ccg cuc  cguugucaagaaguu accgu cgaaau cg   c
   ------uu   ----ucc   u   -c               g     -      -  acc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr17: 1585713-1585823 [-]
intergenic
Database links

Mature sequence ggo-miR-22

Accession MIMAT0024097
Sequence

71 - 

aagcugccaguugaagaacug

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).