Stem-loop sequence ggo-mir-146b

AccessionMI0020643 (change log)
DescriptionGorilla gorilla miR-146b stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   -------------gaacuuuggcca  u      g        au        cu  ga  u 
5'                          cc ggcacu agaacuga  uccauagg  gu  gc c
                            || |||||| ||||||||  ||||||||  ||  ||  
3'                          gg ccgugg ucuugacu  aggugucc  ua  cg u
   ggaaccguaacuacaacaucgugac  c      -        -c        cg  -a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr10: 117112453-117112562 [+]
sense
ENSGGOT00000006992 ; GBF1-201; intron 40
Database links

Mature sequence ggo-miR-146b

Accession MIMAT0024096
Sequence

21 - 

ugagaacugaauuccauaggcugu

 - 44

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).