Stem-loop sequence ggo-mir-127

AccessionMI0020641 (change log)
DescriptionGorilla gorilla miR-127 stem-loop
Gene family MIPF0000080; mir-127
Literature search

1 open access papers mention ggo-mir-127
(1 sentences)

Stem-loop
   guaaaaggucuc c  u   ca   ucu      ugcug         g  c      --  a 
5'             g ug gau  cug   ccagcc     aagcucaga gg ucugau  uc g
               | || |||  |||   ||||||     ||||||||| || ||||||  || a
3'             c ac cug  ggc   ggucgg     uucgagucu cc aggcua  ag a
   ---------cua u  u   aa   --u      -----         g  u      cu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr14: 84900208-84900318 [+]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-127
ggo-mir-337chr14: 84891732-84891840 [+]
ggo-mir-431chr14: 84898290-84898400 [+]
ggo-mir-433chr14: 84899122-84899230 [+]
ggo-mir-127chr14: 84900208-84900318 [+]
ggo-mir-432chr14: 84901722-84901831 [+]
ggo-mir-136chr14: 84901948-84902029 [+]
Database links

Mature sequence ggo-miR-127

Accession MIMAT0024094
Sequence

71 - 

ucggauccgucugagcuuggc

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).