Stem-loop sequence ggo-mir-340

AccessionMI0020634 (change log)
DescriptionGorilla gorilla miR-340 stem-loop
Gene family MIPF0000191; mir-340
Literature search

1 open access papers mention ggo-mir-340
(2 sentences)

Stem-loop
   --------accguuu     u      au       -caa      u    g     ug 
5'                guacc ggugug  uauaaag    ugagac gauu ucaua  u
                  ||||| ||||||  |||||||    |||||| |||| |||||  c
3'                uaugg ccauac  auauuuc    acucug cuag ggugu  g
   cuagacaccauauuc     u      cg       auug      c    -     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr5: 164075953-164076063 [-]
sense
ENSGGOT00000001146 ; RNF130-201; intron 1
ENSGGOT00000027142 ; RNF130-202; intron 1
Database links

Mature sequence ggo-miR-340

Accession MIMAT0024087
Sequence

21 - 

uuauaaagcaaugagacugau

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).