Stem-loop sequence ggo-mir-29c

AccessionMI0020631 (change log)
DescriptionGorilla gorilla miR-29c stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   gggagcaccacuggccca         -  ggc           ucc       ---     u 
5'                   ucucuuaca ca   ugaccgauuuc   ugguguu   cagag c
                     ||||||||| ||   |||||||||||   |||||||   ||||| u
3'                   gggggaugu gu   auuggcuaaag   accacga   guuuu g
   ----------gacgaaaa         a  ---           uuu       ucu     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chr1: 187601536-187601647 [-]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-29c
ggo-mir-29b-2chr1: 187602134-187602214 [-]
ggo-mir-29cchr1: 187601536-187601647 [-]
Database links

Mature sequence ggo-miR-29c

Accession MIMAT0024084
Sequence

71 - 

uagcaccauuugaaaucgguua

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).